WormBase Tree Display for Variation: WBVar00091272
expand all nodes | collapse all nodes | view schema
WBVar00091272 | Name | Public_name | nj3 | ||
---|---|---|---|---|---|
Other_name | CE29092:p.Trp218Ter | ||||
CE47095:p.Trp274Ter | |||||
F57F5.5b.1:c.392delinsA | |||||
F57F5.5a.3:c.653delinsA | |||||
F57F5.5a.1:c.653delinsA | |||||
CE46445:p.Trp131Ter | |||||
F57F5.5c.1:c.821delinsA | |||||
F57F5.5a.2:c.653delinsA | |||||
HGVSg | CHROMOSOME_V:g.12018711delinsT | ||||
Sequence_details | SMap | S_parent | Sequence | F57F5 | |
Flanking_sequences | ttcataaacgttgccatgaagatgttgtat | aagtgtcctggaaataaggcagatgctgta | |||
Mapping_target | F57F5 | ||||
Type_of_mutation | Substitution | gg | rr | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00021993 | ||||
WBStrain00058217 | |||||
Laboratory | IK | ||||
Status | Live | ||||
Affects | Gene | WBGene00004032 | |||
Transcript | F57F5.5b.1 | VEP_consequence | stop_gained | ||
VEP_impact | HIGH | ||||
HGVSc | F57F5.5b.1:c.392delinsA | ||||
HGVSp | CE46445:p.Trp131Ter | ||||
cDNA_position | 464-465 | ||||
CDS_position | 392-393 | ||||
Protein_position | 131 | ||||
Exon_number | 4/12 | ||||
Codon_change | tGG/tAG | ||||
Amino_acid_change | W/* | ||||
F57F5.5a.1 | VEP_consequence | stop_gained | |||
VEP_impact | HIGH | ||||
HGVSc | F57F5.5a.1:c.653delinsA | ||||
HGVSp | CE29092:p.Trp218Ter | ||||
cDNA_position | 675-676 | ||||
CDS_position | 653-654 | ||||
Protein_position | 218 | ||||
Exon_number | 6/14 | ||||
Codon_change | tGG/tAG | ||||
Amino_acid_change | W/* | ||||
F57F5.5a.2 | VEP_consequence | stop_gained | |||
VEP_impact | HIGH | ||||
HGVSc | F57F5.5a.2:c.653delinsA | ||||
HGVSp | CE29092:p.Trp218Ter | ||||
cDNA_position | 850-851 | ||||
CDS_position | 653-654 | ||||
Protein_position | 218 | ||||
Exon_number | 8/16 | ||||
Codon_change | tGG/tAG | ||||
Amino_acid_change | W/* | ||||
F57F5.5c.1 | VEP_consequence | stop_gained | |||
VEP_impact | HIGH | ||||
HGVSc | F57F5.5c.1:c.821delinsA | ||||
HGVSp | CE47095:p.Trp274Ter | ||||
cDNA_position | 821-822 | ||||
CDS_position | 821-822 | ||||
Protein_position | 274 | ||||
Exon_number | 7/14 | ||||
Codon_change | tGG/tAG | ||||
Amino_acid_change | W/* | ||||
F57F5.5a.3 | VEP_consequence | stop_gained | |||
VEP_impact | HIGH | ||||
HGVSc | F57F5.5a.3:c.653delinsA | ||||
HGVSp | CE29092:p.Trp218Ter | ||||
cDNA_position | 821-822 | ||||
CDS_position | 653-654 | ||||
Protein_position | 218 | ||||
Exon_number | 7/15 | ||||
Codon_change | tGG/tAG | ||||
Amino_acid_change | W/* | ||||
Interactor | WBInteraction000502718 | ||||
WBInteraction000502719 | |||||
WBInteraction000505135 | |||||
WBInteraction000536164 | |||||
WBInteraction000536165 | |||||
Genetics | Interpolated_map_position | V | 3.58628 | ||
Description | Phenotype (21) | ||||
Reference (4) | |||||
Remark | nj3 is either a W(218)Amber or W(218)Opal mutation | Paper_evidence | WBPaper00025220 | ||
Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00004032 Amber_UAG_or_Opal_UGA W(218) to stop | Paper_evidence | WBPaper00025220 | |||
Method | Substitution_allele |