WormBase Tree Display for Variation: WBVar00091272
expand all nodes | collapse all nodes | view schema
WBVar00091272 | Name | Public_name | nj3 | ||
---|---|---|---|---|---|
Other_name | CE29092:p.Trp218Ter | ||||
CE47095:p.Trp274Ter | |||||
F57F5.5b.1:c.392delinsA | |||||
F57F5.5a.3:c.653delinsA | |||||
F57F5.5a.1:c.653delinsA | |||||
CE46445:p.Trp131Ter | |||||
F57F5.5c.1:c.821delinsA | |||||
F57F5.5a.2:c.653delinsA | |||||
HGVSg | CHROMOSOME_V:g.12018711delinsT | ||||
Sequence_details | SMap | S_parent | Sequence | F57F5 | |
Flanking_sequences | ttcataaacgttgccatgaagatgttgtat | aagtgtcctggaaataaggcagatgctgta | |||
Mapping_target | F57F5 | ||||
Type_of_mutation | Substitution | gg | rr | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00021993 | ||||
WBStrain00058217 | |||||
Laboratory | IK | ||||
Status | Live | ||||
Affects (3) | |||||
Genetics | Interpolated_map_position | V | 3.58628 | ||
Description | Phenotype (21) | ||||
Reference | WBPaper00043908 | ||||
WBPaper00031535 | |||||
WBPaper00037875 | |||||
WBPaper00065955 | |||||
Remark | nj3 is either a W(218)Amber or W(218)Opal mutation | Paper_evidence | WBPaper00025220 | ||
Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00004032 Amber_UAG_or_Opal_UGA W(218) to stop | Paper_evidence | WBPaper00025220 | |||
Method | Substitution_allele |