WormBase Tree Display for Variation: WBVar00088388
expand all nodes | collapse all nodes | view schema
WBVar00088388 | Evidence | Author_evidence | De Bono M | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ky13 | |||||||
Other_name | C39E6.6.1:c.181C>T | ||||||||
CE06941:p.Gln61Ter | |||||||||
HGVSg | CHROMOSOME_X:g.4769358G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | C39E6 | |||||
Flanking_sequences | ctgtgaattatcattaaatttcagagcgtt | aaaacatattcattctgaacctggcggcga | |||||||
Mapping_target | C39E6 | ||||||||
Type_of_mutation | Substitution | c | t | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00005261 | ||||||||
Laboratory | CX | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003807 | |||||||
Transcript | C39E6.6.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | C39E6.6.1:c.181C>T | ||||||||
HGVSp | CE06941:p.Gln61Ter | ||||||||
cDNA_position | 192 | ||||||||
CDS_position | 181 | ||||||||
Protein_position | 61 | ||||||||
Exon_number | 3/11 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
Interactor | WBInteraction000520368 | ||||||||
WBInteraction000524561 | |||||||||
WBInteraction000563597 | |||||||||
Genetics | Interpolated_map_position | X | -6.64648 | ||||||
Description | Phenotype | WBPhenotype:0000016 | Paper_evidence | WBPaper00031872 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | % animals paralyzed after 60 min on 1mM aldicarb was significantly higher than % N2 animals paralyzed. | Paper_evidence | WBPaper00031872 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003650 | Paper_evidence | WBPaper00031872 | |||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007833 | PATO:0001549 | Paper_evidence | WBPaper00031872 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000420 | Paper_evidence | WBPaper00031872 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | % animals paralyzed after 60 min on 200mM levamisole was significantly higher than % N2 animals paralyzed under same conditions. | Paper_evidence | WBPaper00031872 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00004019 | Paper_evidence | WBPaper00031872 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000655 | Paper_evidence | WBPaper00031872 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Rate of endogenous IPSCs (53%) were significantly decreased compared to wild-type. | Paper_evidence | WBPaper00031872 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000660 | Paper_evidence | WBPaper00005511 | |||||||
WBPaper00003187 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Remark | Social feeders aggregated within 20 min of being placed on a fresh food source. Increasing population density in the presence of food, stimulated aggregation in npr-1 strains | Paper_evidence | WBPaper00005511 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Animals exhibited striking clumping behavior on food. In order of p | Paper_evidence | WBPaper00003187 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00003187 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00005511 | ||||||
WBPaper00003187 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00005511 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Animals were assayed on a bacterial lawn. | Paper_evidence | WBPaper00003187 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000662 | Paper_evidence | WBPaper00003187 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals moved twice as fast as N2 in the presence of food, although in the absence of food, animals moved at a speed indistinguishable from N2. Strength of hyperactivity on food ad609 > ky13, n1353 > g320. | Paper_evidence | WBPaper00003187 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00003187 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00003187 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001013 | Paper_evidence | WBPaper00032196 | |||||||
WBPaper00032501 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2021 | |||||||||
Remark | Animals were more susceptible to infection by P. aeruginosa, S. enterica and E. faecalis than N2 animals. | Paper_evidence | WBPaper00032196 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
npr-1 alleles had enhanced susceptibility to killing by PA14 | Paper_evidence | WBPaper00032501 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00032501 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Strain | WBStrain00005261 | Paper_evidence | WBPaper00032196 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001273 | Paper_evidence | WBPaper00038142 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutants had significantly higher thermal thresholds than wild-type N2 worms. | Paper_evidence | WBPaper00038142 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001319 | Paper_evidence | WBPaper00031872 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Rate of endogenous IPSCs were significantly decreased (53%) compared to wild-type. | Paper_evidence | WBPaper00031872 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001765 | Paper_evidence | WBPaper00031935 | |||||||
WBPaper00031936 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2021 | |||||||||
Remark | Animals showed reduced avoidance to 5% carbon dioxide both in the presence and absence of food. | Paper_evidence | WBPaper00031935 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
A hypomorphic mutation in npr-1 in an N2 background results in reduced CO2 avoidance | Paper_evidence | WBPaper00031936 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031935 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Hypomorph_reduction_of_function | Paper_evidence | WBPaper00031936 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00031936 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Strains were maintained at 22C. | Paper_evidence | WBPaper00031935 | |||||
Curator_confirmed | WBPerson712 | ||||||||
10% CO2 | Paper_evidence | WBPaper00031936 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_not_observed | WBPhenotype:0000637 | Paper_evidence | WBPaper00003187 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals did not appear to have any defects in dauer formation. | Paper_evidence | WBPaper00003187 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00003187 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00003187 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were assayed on a bacterial lawn. | Paper_evidence | WBPaper00003187 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000847 | Paper_evidence | WBPaper00031872 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The density of GFP::SNB-1 puncta in GABAergic axons was unaltered compared to N2 | Paper_evidence | WBPaper00031872 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005190 | PATO:0000460 | Paper_evidence | WBPaper00031872 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | Punc-129::GFP::SNB-1 | Paper_evidence | WBPaper00031872 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001320 | Paper_evidence | WBPaper00031872 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | IPSC amplitudes were normal. | Paper_evidence | WBPaper00031872 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001991 | Paper_evidence | WBPaper00034694 | |||||||
Curator_confirmed | WBPerson2857 | ||||||||
Remark | animals enter into hypoxia-induced reproductive and developmental diapause same as wild-type | Paper_evidence | WBPaper00034694 | ||||||
Curator_confirmed | WBPerson2857 | ||||||||
Reference (16) | |||||||||
Method | Substitution_allele |