WormBase Tree Display for Variation: WBVar00087918
expand all nodes | collapse all nodes | view schema
WBVar00087918 | Evidence | Paper_evidence | WBPaper00031592 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | hp102 | |||||
Other_name (32) | |||||||
HGVSg | CHROMOSOME_IV:g.6168669C>T | ||||||
Sequence_details | SMap | S_parent | Sequence | C11D2 | |||
Flanking_sequences | ctgtaatcactgaaacatttgctgaaattc | agtccagttcagtgaaatgtggcagaaaaa | |||||
Mapping_target | C11D2 | ||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00031592 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | ZM | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00006809 | |||||
Transcript (16) | |||||||
Genetics | Interpolated_map_position | IV | 3.08513 | ||||
Description | Phenotype | WBPhenotype:0000004 | Paper_evidence | WBPaper00031592 | |||
Curator_confirmed | WBPerson712 | ||||||
Semi_dominant | Paper_evidence | WBPaper00031592 | |||||
Curator_confirmed | WBPerson712 | ||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00031592 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000565 | Paper_evidence | WBPaper00031592 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Mutants showed semi-dominant, uncoordinated, and exaggerated body bends during either spontaneous or stimulated locomotion. | Paper_evidence | WBPaper00031592 | ||||
Curator_confirmed | WBPerson712 | ||||||
Semi_dominant | Paper_evidence | WBPaper00031592 | |||||
Curator_confirmed | WBPerson712 | ||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00031592 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000616 | Paper_evidence | WBPaper00031592 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Animals exhibited unusually large HSN synapses. | Paper_evidence | WBPaper00031592 | ||||
Curator_confirmed | WBPerson712 | ||||||
Semi_dominant | Paper_evidence | WBPaper00031592 | |||||
Curator_confirmed | WBPerson712 | ||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00031592 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000679 | Paper_evidence | WBPaper00031592 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Animals exhibited abnormal active zone marker distribution. | Paper_evidence | WBPaper00031592 | ||||
Curator_confirmed | WBPerson712 | ||||||
Semi_dominant | Paper_evidence | WBPaper00031592 | |||||
Curator_confirmed | WBPerson712 | ||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00031592 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0001316 | Paper_evidence | WBPaper00031592 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | No ePSC could be evoked. | Paper_evidence | WBPaper00031592 | ||||
Curator_confirmed | WBPerson712 | ||||||
Semi_dominant | Paper_evidence | WBPaper00031592 | |||||
Curator_confirmed | WBPerson712 | ||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00031592 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0001319 | Paper_evidence | WBPaper00031592 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Some animals displayed a normal frequency of mPSC while others had no mPSC at all. | Paper_evidence | WBPaper00031592 | ||||
Curator_confirmed | WBPerson712 | ||||||
Semi_dominant | Paper_evidence | WBPaper00031592 | |||||
Curator_confirmed | WBPerson712 | ||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00031592 | ||||
Curator_confirmed | WBPerson712 | ||||||
Disease_info (2) | |||||||
Reference | WBPaper00031592 | ||||||
Method | Substitution_allele |