WormBase Tree Display for Variation: WBVar00000014

WBVar00000014 Evidence: Paper_evidence: WBPaper00006439
  Name: Public_name: ad465
    Other_name: Y48B6A.4.1:c.320G>A
      CE22119:p.Trp107Ter
    HGVSg: CHROMOSOME_II:g.14170812C>T
  Sequence_details: SMap: S_parent: Sequence: Y48B6A
    Flanking_sequences: ctacgttgcaaattccccatggtacactat gaaacccgatattctgttattcaacagtgc
    Mapping_target: Y48B6A
    Type_of_mutation: Substitution: g a
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin (4)
  Affects: Gene: WBGene00001133
    Transcript: Y48B6A.4.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: Y48B6A.4.1:c.320G>A
        HGVSp: CE22119:p.Trp107Ter
        cDNA_position: 494
        CDS_position: 320
        Protein_position: 107
        Exon_number: 3/8
        Codon_change: tGg/tAg
        Amino_acid_change: W/*
    Interactor (25)
  Genetics: Interpolated_map_position: II 22.4833
    Mapping_data: In_2_point: 4736
        5206
        5207
        5208
        5209
      In_multi_point: 1675
        1833
        1834
      In_pos_neg_data: 4730
        4735
  Description: Phenotype (14)
    Phenotype_not_observed: WBPhenotype:0000039 Paper_evidence: WBPaper00031694
        Curator_confirmed: WBPerson8126
        Remark: Fig. 4 lifespan extension upon reserpine treatment, not different from wild type Paper_evidence: WBPaper00031694
            Curator_confirmed: WBPerson8126
        Affected_by: Molecule: WBMol:00002955 Paper_evidence: WBPaper00031694
              Curator_confirmed: WBPerson8126
      WBPhenotype:0000042 Paper_evidence: WBPaper00046760
        Curator_confirmed: WBPerson2987
        Remark: Figure 3e Paper_evidence: WBPaper00046760
            Curator_confirmed: WBPerson2987
      WBPhenotype:0000081 Paper_evidence: WBPaper00005996
        Curator_confirmed: WBPerson712
        Remark: eat-2 mutants complete development even at the restrictive temperature. Paper_evidence: WBPaper00005996
            Curator_confirmed: WBPerson712
        Phenotype_assay: Temperature: 25 Paper_evidence: WBPaper00005996
              Curator_confirmed: WBPerson712
      WBPhenotype:0000679 Paper_evidence: WBPaper00005026
        Curator_confirmed: WBPerson712
        Remark: No nuclear localization of DAF-16 was observed in eat-2 mutants at 20 nor 27 degrees C. Paper_evidence: WBPaper00005026
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Paper_evidence: WBPaper00005996
        Curator_confirmed: WBPerson712
        Remark: eat-2 mutants are fertile, even at the restrictive temperature. Paper_evidence: WBPaper00005996
            Curator_confirmed: WBPerson712
        Phenotype_assay: Temperature: 25 Paper_evidence: WBPaper00005996
              Curator_confirmed: WBPerson712
      WBPhenotype:0001616 Paper_evidence: WBPaper00024698
        Curator_confirmed: WBPerson712
        Remark: Trimethadione significantly extended life-span of mutant animals (N=68)(1 ind.exp.), similar in effect to WT animals. Paper_evidence: WBPaper00024698
            Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Lifespan analysis was performed on animals exposed to 4 mg/ml of the drug from fertilization until death. Animals were cultured on NGM plates containing the drug and seeded with OP50. Paper_evidence: WBPaper00024698
              Curator_confirmed: WBPerson712
          Temperature: 20°C Paper_evidence: WBPaper00024698
              Curator_confirmed: WBPerson712
      WBPhenotype:0001775 Paper_evidence: WBPaper00031942
        Curator_confirmed: WBPerson712
        Remark: Like wild-type, growth under thermocycling conditions of 10 minute shifts between 12C and 25C, resulted in a shift in life span more similar to the extended life span of animals reared at 12.5C continuously. Paper_evidence: WBPaper00031942
            Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Animals were grown in microfuge tubes in 100l S medium (maintained) and incubated in thermocyclers. Worms were transferred into autoclaved, sterile microfuge tubes either every other day or once every 3 days, dependent upon the strain and stage of life of the worms used. Worms were monitored, counted and fed on a daily basis. Animals were shifted every 10 minutes between 12C and 25C. Paper_evidence: WBPaper00031942
              Curator_confirmed: WBPerson712
          Temperature: 12, 12.5, 18.5, 25 Paper_evidence: WBPaper00031942
              Curator_confirmed: WBPerson712
      WBPhenotype:0001789 Paper_evidence: WBPaper00031942
        Curator_confirmed: WBPerson712
        Remark: Animals displayed basically the same overall pattern as observed with wild-type animals in that animals were short lived at 25C and long lived at 12.5C. Paper_evidence: WBPaper00031942
            Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Animals were grown in microfuge tubes in 100l S medium (maintained) and incubated in thermocyclers. Worms were transferred into autoclaved, sterile microfuge tubes either every other day or once every 3 days, dependent upon the strain and stage of life of the worms used. Worms were monitored, counted and fed on a daily basis. Animals were shifted every 10 minutes between 12C and 25C. Paper_evidence: WBPaper00031942
              Curator_confirmed: WBPerson712
          Temperature: 12, 12.5, 18.5, 25 Paper_evidence: WBPaper00031942
              Curator_confirmed: WBPerson712
  Reference (20)
  Method: Substitution_allele