WormBase Tree Display for Variation: WBVar00000014
expand all nodes | collapse all nodes | view schema
WBVar00000014 | Evidence | Paper_evidence | WBPaper00006439 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | ad465 | ||||||
Other_name | Y48B6A.4.1:c.320G>A | |||||||
CE22119:p.Trp107Ter | ||||||||
HGVSg | CHROMOSOME_II:g.14170812C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | Y48B6A | ||||
Flanking_sequences | ctacgttgcaaattccccatggtacactat | gaaacccgatattctgttattcaacagtgc | ||||||
Mapping_target | Y48B6A | |||||||
Type_of_mutation | Substitution | g | a | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00000030 | |||||||
WBStrain00000031 | ||||||||
WBStrain00005463 | ||||||||
WBStrain00005495 | ||||||||
WBStrain00007214 | ||||||||
Laboratory | DA | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00001133 | ||||||
Transcript | Y48B6A.4.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | Y48B6A.4.1:c.320G>A | |||||||
HGVSp | CE22119:p.Trp107Ter | |||||||
cDNA_position | 494 | |||||||
CDS_position | 320 | |||||||
Protein_position | 107 | |||||||
Exon_number | 3/8 | |||||||
Codon_change | tGg/tAg | |||||||
Amino_acid_change | W/* | |||||||
Interactor (25) | ||||||||
Genetics | Interpolated_map_position | II | 22.4833 | |||||
Mapping_data | In_2_point | 4736 | ||||||
5206 | ||||||||
5207 | ||||||||
5208 | ||||||||
5209 | ||||||||
In_multi_point | 1675 | |||||||
1833 | ||||||||
1834 | ||||||||
In_pos_neg_data | 4730 | |||||||
4735 | ||||||||
Description | Phenotype (14) | |||||||
Phenotype_not_observed | WBPhenotype:0000039 | Paper_evidence | WBPaper00031694 | |||||
Curator_confirmed | WBPerson8126 | |||||||
Remark | Fig. 4 lifespan extension upon reserpine treatment, not different from wild type | Paper_evidence | WBPaper00031694 | |||||
Curator_confirmed | WBPerson8126 | |||||||
Affected_by | Molecule | WBMol:00002955 | Paper_evidence | WBPaper00031694 | ||||
Curator_confirmed | WBPerson8126 | |||||||
WBPhenotype:0000042 | Paper_evidence | WBPaper00046760 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Figure 3e | Paper_evidence | WBPaper00046760 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000081 | Paper_evidence | WBPaper00005996 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | eat-2 mutants complete development even at the restrictive temperature. | Paper_evidence | WBPaper00005996 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Temperature | 25 | Paper_evidence | WBPaper00005996 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000679 | Paper_evidence | WBPaper00005026 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | No nuclear localization of DAF-16 was observed in eat-2 mutants at 20 nor 27 degrees C. | Paper_evidence | WBPaper00005026 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00005996 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | eat-2 mutants are fertile, even at the restrictive temperature. | Paper_evidence | WBPaper00005996 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Temperature | 25 | Paper_evidence | WBPaper00005996 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001616 | Paper_evidence | WBPaper00024698 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Trimethadione significantly extended life-span of mutant animals (N=68)(1 ind.exp.), similar in effect to WT animals. | Paper_evidence | WBPaper00024698 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Lifespan analysis was performed on animals exposed to 4 mg/ml of the drug from fertilization until death. Animals were cultured on NGM plates containing the drug and seeded with OP50. | Paper_evidence | WBPaper00024698 | ||||
Curator_confirmed | WBPerson712 | |||||||
Temperature | 20°C | Paper_evidence | WBPaper00024698 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001775 | Paper_evidence | WBPaper00031942 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Like wild-type, growth under thermocycling conditions of 10 minute shifts between 12C and 25C, resulted in a shift in life span more similar to the extended life span of animals reared at 12.5C continuously. | Paper_evidence | WBPaper00031942 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Animals were grown in microfuge tubes in 100l S medium (maintained) and incubated in thermocyclers. Worms were transferred into autoclaved, sterile microfuge tubes either every other day or once every 3 days, dependent upon the strain and stage of life of the worms used. Worms were monitored, counted and fed on a daily basis. Animals were shifted every 10 minutes between 12C and 25C. | Paper_evidence | WBPaper00031942 | ||||
Curator_confirmed | WBPerson712 | |||||||
Temperature | 12, 12.5, 18.5, 25 | Paper_evidence | WBPaper00031942 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001789 | Paper_evidence | WBPaper00031942 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals displayed basically the same overall pattern as observed with wild-type animals in that animals were short lived at 25C and long lived at 12.5C. | Paper_evidence | WBPaper00031942 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Animals were grown in microfuge tubes in 100l S medium (maintained) and incubated in thermocyclers. Worms were transferred into autoclaved, sterile microfuge tubes either every other day or once every 3 days, dependent upon the strain and stage of life of the worms used. Worms were monitored, counted and fed on a daily basis. Animals were shifted every 10 minutes between 12C and 25C. | Paper_evidence | WBPaper00031942 | ||||
Curator_confirmed | WBPerson712 | |||||||
Temperature | 12, 12.5, 18.5, 25 | Paper_evidence | WBPaper00031942 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference (20) | ||||||||
Method | Substitution_allele |