WormBase Tree Display for Variation: WBVar00143063
expand all nodes | collapse all nodes | view schema
WBVar00143063 | Evidence | Paper_evidence | WBPaper00031175 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e251 | ||||||
Other_name | CE24860:p.Trp452Ter | |||||||
C50C3.9c.1:c.1355G>A | ||||||||
CE32168:p.Trp496Ter | ||||||||
C50C3.9a.1:c.1487G>A | ||||||||
HGVSg | CHROMOSOME_III:g.8197512C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | C50C3 | ||||
Flanking_sequences | cattataaagaatctggacaattatcttggt | gactggagtttacagagaaagattggtgagt | ||||||
Mapping_target | C50C3 | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00031175 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00003936 | |||||||
WBStrain00003974 | ||||||||
WBStrain00004005 | ||||||||
WBStrain00004006 | ||||||||
WBStrain00004135 | ||||||||
WBStrain00004957 | ||||||||
WBStrain00004983 | ||||||||
WBStrain00005015 | ||||||||
WBStrain00005021 | ||||||||
WBStrain00005034 | ||||||||
WBStrain00005523 | ||||||||
WBStrain00005524 | ||||||||
WBStrain00005525 | ||||||||
WBStrain00005641 | ||||||||
WBStrain00005642 | ||||||||
WBStrain00005652 | ||||||||
WBStrain00006353 | ||||||||
WBStrain00007271 | ||||||||
WBStrain00007275 | ||||||||
WBStrain00007983 | ||||||||
WBStrain00007984 | ||||||||
WBStrain00007988 | ||||||||
WBStrain00007990 | ||||||||
WBStrain00007992 | ||||||||
WBStrain00007995 | ||||||||
WBStrain00008002 | ||||||||
WBStrain00008010 | ||||||||
WBStrain00008015 | ||||||||
WBStrain00022526 | ||||||||
WBStrain00022570 | ||||||||
WBStrain00023551 | ||||||||
WBStrain00023965 | ||||||||
WBStrain00026695 | ||||||||
WBStrain00026918 | ||||||||
WBStrain00027012 | ||||||||
WBStrain00027026 | ||||||||
WBStrain00027027 | ||||||||
WBStrain00027029 | ||||||||
WBStrain00027030 | ||||||||
WBStrain00027130 | ||||||||
WBStrain00027202 | ||||||||
WBStrain00027237 | ||||||||
WBStrain00027300 | ||||||||
WBStrain00027362 | ||||||||
WBStrain00027368 | ||||||||
WBStrain00028769 | ||||||||
WBStrain00028773 | ||||||||
WBStrain00030544 | ||||||||
WBStrain00034243 | ||||||||
WBStrain00034377 | ||||||||
WBStrain00034378 | ||||||||
WBStrain00034379 | ||||||||
WBStrain00034390 | ||||||||
WBStrain00034391 | ||||||||
WBStrain00034401 | ||||||||
WBStrain00034409 | ||||||||
WBStrain00034410 | ||||||||
WBStrain00034411 | ||||||||
WBStrain00034412 | ||||||||
WBStrain00034413 | ||||||||
WBStrain00034414 | ||||||||
WBStrain00034415 | ||||||||
WBStrain00040219 | ||||||||
WBStrain00040220 | ||||||||
WBStrain00040610 | ||||||||
WBStrain00051881 | ||||||||
WBStrain00055413 | ||||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00006772 | ||||||
Transcript | C50C3.9a.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | C50C3.9a.1:c.1487G>A | |||||||
HGVSp | CE32168:p.Trp496Ter | |||||||
cDNA_position | 1588 | |||||||
CDS_position | 1487 | |||||||
Protein_position | 496 | |||||||
Exon_number | 9/18 | |||||||
Codon_change | tGg/tAg | |||||||
Amino_acid_change | W/* | |||||||
C50C3.9c.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C50C3.9c.1:c.1355G>A | |||||||
HGVSp | CE24860:p.Trp452Ter | |||||||
cDNA_position | 1467 | |||||||
CDS_position | 1355 | |||||||
Protein_position | 452 | |||||||
Exon_number | 8/17 | |||||||
Codon_change | tGg/tAg | |||||||
Amino_acid_change | W/* | |||||||
Interactor | WBInteraction000052098 | |||||||
WBInteraction000052102 | ||||||||
WBInteraction000502423 | ||||||||
WBInteraction000502424 | ||||||||
Genetics | Interpolated_map_position | III | -0.373497 | |||||
Mapping_data | In_2_point (12) | |||||||
In_multi_point (86) | ||||||||
In_pos_neg_data | 807 | |||||||
818 | ||||||||
1617 | ||||||||
3807 | ||||||||
Description | Phenotype (20) | |||||||
Phenotype_not_observed | WBPhenotype:0001182 | Paper_evidence | WBPaper00031915 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Mutants had wild-type fat content | Paper_evidence | WBPaper00031915 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Treatment | Fat content was visualized by Nile red staining | Paper_evidence | WBPaper00031915 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001645 | Paper_evidence | WBPaper00040284 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Table 1 | Paper_evidence | WBPaper00040284 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | No disruption of ASE asymmetry (as seen with lim-6 reporters) | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Genotype | otIs114, otIs6 | Paper_evidence | WBPaper00006052 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001811 | Paper_evidence | WBPaper00031915 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Mutants were susceptible to the fat-reducing effects of exogenously administered serotonin | Paper_evidence | WBPaper00031915 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Treatment | Reduced fat content of 5-HT-treated animals was visualized by Nile red staining and confirmed by thin-layer chromatography (TLC) quantitation of total triglycerides extracted from vehicle- and 5-HT-treated worms and by Sudan black fat staining | Paper_evidence | WBPaper00031915 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Reference (31) | ||||||||
Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006772 Amber_UAG_or_Opal_UGA | |||||||
Method | Substitution_allele |