WormBase Tree Display for Transgene: WBTransgene00015849
expand all nodes | collapse all nodes | view schema
WBTransgene00015849 | Public_name | vsIs163 | |
---|---|---|---|
Summary | [Pmod-1::mCherry] | ||
Construction | Construct | WBCnstr00015424 | |
Integration_method | UV_TMP | ||
Construction_summary | The mod-1::mCherry reporter plasmid pGG17 was constructed by inserting a 1645 bp mod-1 promoter fragment upstream and the 1172 bp 3' untranslated region (UTR) of mod-1 downstream of the mCherry coding sequences to generate plasmid pGG17. The primers used to amplify the promoter were GACTCTGCAGGCGTTCGTCACATTCTGCCG and CTGAGGTACCAATTTTCTTTCACCGCATTGGC. The primers used to amplify the 3' UTR were GACTGAGCTCTTGAAGTTTATCCCTT and GACTGGGCCCTAATCACAGGTGTCATCGG. Injection of pGG17 into C. elegans gave transgenes showing very weak mCherry expression, but following the method of Etchberger and Hobert (2008) we found that PCR amplification of the promoter::mCherry::3' UTR cassette from the plasmid and injection of the linear amplified DNA gave much stronger expression. An extrachromosomal transgene generated in this manner was chromosomally integrated using psoralen/UV mutagenesis to produce two independent integrated transgenes, vsIs154 and vsIs163. | ||
Genetic_information | Integrated | ||
Used_for | Expr_pattern | Expr10553 | |
Associated_with | Strain | WBStrain00043962 | |
WBStrain00043963 | |||
Reference | WBPaper00041535 | ||
Species | Caenorhabditis elegans |