WormBase Tree Display for Transgene: WBTransgene00015847
expand all nodes | collapse all nodes | view schema
| WBTransgene00015847 | Public_name | vsIs123 | |
|---|---|---|---|
| Summary | [MOD-1(+); lin-15(+)] | ||
| Construction | Construct | WBCnstr00015422 | |
| Integration_method | UV_TMP | ||
| Construction_summary | This mod-1 overexpressing transgene vsIs123 was generated by directly microinjecting a long-range PCR product containing the entire mod-1 gene into a lin-15(n765ts) strain of C. elegans with the lin-15 rescuing plasmid pL15EK, selecting non-Lin progeny, and subsequently using psoralen/UV mutagenesis to chromosomally integrate the transgene. The mod-1 PCR product was amplified from C. elegans genomic DNA using the primers CTAATCACAGGTGTCATCGG and GCGTTCGTCACATTCTGCCG. | ||
| Genetic_information | Integrated | ||
| Associated_with | Strain | WBStrain00043943 | |
| WBStrain00043959 | |||
| Reference | WBPaper00041535 | ||
| Species | Caenorhabditis elegans |
