WormBase Tree Display for Transgene: WBTransgene00015144
expand all nodes | collapse all nodes | view schema
| WBTransgene00015144 | Public_name | neSi18 | |
|---|---|---|---|
| Summary | [21U Reporter 2 (Ppie-1::GFP/histone 2B::unc-54-3'UTR), cb-unc-119(+)] | ||
| Construction | Construct | WBCnstr00014743 | |
| Integration_method | Single_copy_insertion | ||
| Construction_summary | GFP is expressed. The pie-1 promoter, GFP/histone 2B, and unc-54 3' UTR fragments were recombined using plasmids pCG142, pCM1.35, and pCM5.37, respectively, in a Gateway reaction with the pCFJ150 destination vector to create the final vector for insertion at Mos1(ttTi5605) on LGII. The 21U-RNA target sites were introduced into the unc-54 3 UTR in pCM5.37 between the sequences ttactcttcaacatccctacatgc and tctttctccctgtgctcccacc by plasmid PCR with primers containing the inserted sequences, followed by DpnI digestion, phosphorylation with PNK, and ligation with T4 DNA ligase. | ||
| Genetic_information | Integrated | ||
| Map | II | ||
| Associated_with | Strain | WBStrain00046593 | |
| Reference | WBPaper00041240 | ||
| Species | Caenorhabditis elegans |
