WormBase Tree Display for Strain: WBStrain00052057
expand all nodes | collapse all nodes | view schema
| WBStrain00052057 | Status | Live | ||
|---|---|---|---|---|
| Genotype | pph-5(udn91) V. | |||
| Public_name | UDN100161 | |||
| Contains | Gene | WBGene00012665 | ||
| Disease_info | Models_disease | DOID:0112202 | ||
| Models_disease_in_annotation | WBDOannot00001435 | |||
| Properties | Outcrossed | x2 | ||
| Mutagen | CRISPR_Cas9 | |||
| CGC_received | 30 Mar 2022 00:00:00 | |||
| Location | CGC | |||
| Remark | pph-5 [A48T] #2 variant edit from Fielder, et al. (2022). Includes addition of silent AvaII restriction site and silent PAM ablation. Homozygous viable and superficially wild-type. Genotype using primers Forward: accggaaattgtcccaaaat, Reverse: tttccgactttctggaggtg. Digest with AvaII restriction enzyme for resulting sizes of 401bp +403bp. Wild-type product will not be digested. | Inferred_automatically | From CGC strain data | |
| Made_by: UDN Screening Center | CGC_data_submission | |||
| Species | Caenorhabditis elegans |
