WormBase Tree Display for Strain: WBStrain00051531
expand all nodes | collapse all nodes | view schema
| WBStrain00051531 | Status | Live | ||
|---|---|---|---|---|
| Genotype | npr-33(sy1272) X. | |||
| Public_name | PS8317 | |||
| Contains | Gene | WBGene00009278 | ||
| Variation | WBVar02157642 | |||
| Properties | Outcrossed | x0 | ||
| Mutagen | CRISPR_Cas9 | |||
| CGC_received | 15 Jun 2022 00:00:00 | |||
| Location | PS | |||
| CGC | ||||
| Remark | Batch Strain object requested via get_NS_ids.pl | |||
| Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of npr-33. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CAAACGAGCACATTGATAAGTGTACTGGCCACCC right flanking sequence: AATCAGCTCCGCTTCAATGCTTTTCCTGTCATCCG Inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTGAAGCGGAGCTGATTGGG Method Reference: G3 (Bethesda).2018 Nov 6;8(11):3607-3616 | Inferred_automatically | From CGC strain data | ||
| Made_by: Heenam Park & Mandy Tan | CGC_data_submission | |||
| Reference | WBPaper00062108 | |||
| Species | Caenorhabditis elegans |
