WormBase Tree Display for Strain: WBStrain00047162
expand all nodes | collapse all nodes | view schema
| WBStrain00047162 | Status | Live | ||
|---|---|---|---|---|
| Genotype | flp-34(sy810) V. | |||
| Public_name | PS7220 | |||
| Contains | Gene | WBGene00019975 | ||
| Variation | WBVar02152918 | |||
| Properties | Outcrossed | x3 | ||
| Mutagen | CRISPR_Cas9 | |||
| CGC_received | 18 Jul 2022 00:00:00 | |||
| Location | PS | |||
| CGC | ||||
| Made_by | WBPerson22859 | |||
| Remark | [2020-04-22T18:02:02.194Z WBPerson2987] New Strain: WBPaper00053388 CRISPR mutant; genotype flp-34(sy810) | Curator_confirmed | WBPerson2987 | |
| flp-34(sy810) is a CRISPR/Cas9-engineered 1,365-bp deletion flanked by the sequences TCAAATTTTTTGAGGAAATCCTCCTGAAAC and AATATTTTCGAGTTTCGAAACATTTCAAAT with a AATATATTTTCGAGTTTCGAAACATATTTTCGAGTTTCGAAACAC insertion. Reference: Lee JS, et al. Proc Natl Acad Sci USA. 2017 Dec 12;114(50):E10726-E10735. PMID: 29167374 | Inferred_automatically | From CGC strain data | ||
| Reference | WBPaper00053388 | |||
| Species | Caenorhabditis elegans |
