WormBase Tree Display for RNAi: WBRNAi00075626
expand all nodes | collapse all nodes | view schema
WBRNAi00075626 | Homol | Homol_homol | F45H11:RNAi | ||
---|---|---|---|---|---|
Sequence_info | DNA_text | gaaaatgtattcatataaaatgtaaactcccgtctgaattgagcccgctccaaatagaaacgagtcacagtcccgaatgtcccgtttttatgtccaatctctccaactttcaatatttattgttacatcagttctttaaatcatattcctcattttattttctgtgttcaaataaataatgcattctt | |||
Experiment | Laboratory | PC | |||
Date | 07 Jul 2000 00:00:00 | ||||
Strain | WBStrain00000001 | ||||
Delivered_by | Injection | ||||
Inhibits | Gene | WBGene00003587 | Inferred_automatically | RNAi_primary | |
Transcript | F45H11.2.1 | Inferred_automatically | RNAi_primary | ||
Species | Caenorhabditis elegans | ||||
Reference | WBPaper00004363 | ||||
Phenotype | WBPhenotype:0000007 | Remark | low percentage of embryos hatch internally | ||
Penetrance | Low | ||||
WBPhenotype:0000038 | |||||
WBPhenotype:0000050 | Penetrance | Low | |||
WBPhenotype:0000059 | Penetrance | Low | |||
WBPhenotype:0000280 | Remark | had patchy interruptions in the alae in which the ridges were absent or replaced by an irregular pattern of small raised spots | |||
WBPhenotype:0000505 | |||||
WBPhenotype:0000696 | |||||
WBPhenotype:0001364 | |||||
Phenotype_not_observed | WBPhenotype:0000170 | ||||
Remark | authors used 188 bases of the untranslated 3 prime end for RNAi | ||||
Method | RNAi |