WormBase Tree Display for RNAi: WBRNAi00061318
expand all nodes | collapse all nodes | view schema
WBRNAi00061318 | Homol | Homol_homol | Y60A3A:RNAi | ||
---|---|---|---|---|---|
Sequence_info | DNA_text | atggagcagtttgacggcttcgagtacagcaaacgggaccttttaggtcatggagcatttgcaattgtatacagaggacgctatgttgatcgcacagacgtgccagttgccatcaaggcgatcgccaagaagaatatcagcaaatcaaagaatctgctgacaaaagagattaaaattctaaaagaattgtcaagcctgaagcatgaaaatcttgtgggcctactcaaatgcacggagacccctactcatgtgtatttggttatggaattctgtaatggaggagatttggctgattatttacaacagaagactacattgaatgaggatactattcaacattttgtcgtgcaaattgctcacgcgttggaagcgatcaacaaaaagggcatcgtacatcgtgatttgaagcc | |||
Experiment | Laboratory | NG | |||
Date | 22 Sep 2004 00:00:00 | ||||
Genotype | unc-51(e369) | ||||
Delivered_by | Bacterial_feeding | ||||
Inhibits | Predicted_gene | Y60A3A.1 | Inferred_automatically | RNAi_primary | |
Gene | WBGene00006786 | Inferred_automatically | RNAi_primary | ||
Transcript | Y60A3A.1.1 | Inferred_automatically | RNAi_primary | ||
Species | Caenorhabditis elegans | ||||
Reference | WBPaper00024595 | ||||
Phenotype | WBPhenotype:0001224 | Remark | unc-51 RNAi was able to enhance the CAN axon defect of unc-51(e369). | ||
Method | RNAi |