WormBase Tree Display for Feature: WBsf978996
expand all nodes | collapse all nodes | view schema
| WBsf978996 | SMap | S_parent | Sequence | Y57A10A |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | gatgctccactcgtcgggaacccatcccat | atgacaagccggattttgcaacgattcttc | |
| Mapping_target | Y57A10A | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | Promoter region of Y57A10A.27. | ||
| SO_term | SO:0000167 | |||
| Defined_by | Defined_by_paper | WBPaper00042525 | ||
| Associations | Associated_with_gene | WBGene00013267 | ||
| Associated_with_Interaction (35) | ||||
| Remark | [150922 gw3] This is a region upstream of Y57A10A.27 used as bait in the eY1H method described in the paper. | Paper_evidence | WBPaper00042525 | |
| Method | promoter |
