WormBase Tree Display for Feature: WBsf977530
expand all nodes | collapse all nodes | view schema
WBsf977530 | SMap | S_parent | Sequence | R74 |
---|---|---|---|---|
Name | Public_name | IRE-1 binding and splicing site | ||
Sequence_details | Flanking_sequences | gttgtcgtcgtcggaggagaggatcgccgt | tccacctccatcaacaacaacatcagcaac | |
Mapping_target | R74 | |||
DNA_text | gcctttgaatcagcagcattcattaatgagcctcagcagtgggaacaggcccga | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | This is the 'IRE-1' binding site for xbp-1 where a 23 bp intron in spliced out. | ||
SO_term | SO:0000409 | |||
Defined_by | Defined_by_paper | WBPaper00005036 | ||
WBPaper00005044 | ||||
Associations | Associated_with_gene | WBGene00006959 | ||
Associated_with_Interaction | WBInteraction000521984 | |||
Bound_by_product_of | WBGene00002147 | |||
Remark | IRE-1 is a stress-activated endonuclease resident in the ER that is conserved in all known eukaryotes. IRE-1 mediated unconventional splicing of an intron from xbp-1 mRNA controls expression of the encoded transcription factor and is required for upregulation of most UPR target genes. IRE-1 binds to two stem-loop structures in this region of the mRNA that flank the intron that is spliced. [2014-09-03 gw3] | |||
Method | binding_site |