WormBase Tree Display for Feature: WBsf919622
expand all nodes | collapse all nodes | view schema
WBsf919622 | SMap | S_parent | Sequence | C42D8 |
---|---|---|---|---|
Name | Public_name | VPE2 at -150 to -144 in Figure 2A of WBPaper00001523 | ||
Sequence_details | Flanking_sequences | agacagggctctcaccgaatgttgcaatttgttt | gggtcacaaagcggagcgaatgcttgaatgtgtc | |
Mapping_target | C42D8 | |||
DNA_text | CTGATAA | |||
Origin | Species | Caenorhabditis elegans | ||
History | Acquires_merge | WBsf899549 | ||
Visible | Description | This is a conserved 'vit promoter element 2' (VPE2) for the gene vit-2. | ||
SO_term | SO:0005836 | |||
Defined_by | Defined_by_paper | WBPaper00001523 | ||
WBPaper00001864 | ||||
Associations | Associated_with_gene | WBGene00006926 | ||
Remark | This is a conserved 'vit promoter element 2' (VPE2) for the gene vit-2. [2013-07-23 gw3] | |||
Method | regulatory_region |