WormBase Tree Display for Feature: WBsf656642
expand all nodes | collapse all nodes | view schema
WBsf656642 | SMap | S_parent | Sequence | R05D11 |
---|---|---|---|---|
Name | Public_name | MCP_0000003483 | ||
Sequence_details | Flanking_sequences | acatacgtttgtataaaaatcttcgaaact | gattctcccaatactgtgttgatccaaggg | |
Mapping_target | R05D11 | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | Clustered region of TSS sites. Number of tags=4. Shape score=0.5. Assignement type=transcript_body. Mode position in cluster=11. | ||
SO_term | SO:0001240 | |||
Defined_by | Defined_by_paper | WBPaper00042246 | ||
Score | 4 | |||
Associations | Associated_with_gene | WBGene00011034 | ||
Remark | [130712 gw3] This is a TSS cluster region from Julie Ahringer's paper. We hope to add details for the TSS sites later. | |||
Method | TSS_region |