WormBase Tree Display for Feature: WBsf644217
expand all nodes | collapse all nodes | view schema
WBsf644217 | SMap | S_parent | Sequence | C25H3 |
---|---|---|---|---|
Name | Public_name | MCP_0000007728 | ||
Sequence_details | Flanking_sequences | aaaagatatcatttaatacatcttttatgt | aataattatgcaatactgtcctttaaagtt | |
Mapping_target | C25H3 | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | Clustered region of TSS sites. Number of tags=32. Shape score=0.3125. Assignement type=wormbase_tss. Mode position in cluster=16. | ||
SO_term | SO:0001240 | |||
Defined_by | Defined_by_paper | WBPaper00042246 | ||
Score | 32 | |||
Associations | Associated_with_gene | WBGene00044391 | ||
Remark | [130712 gw3] This is a TSS cluster region from Julie Ahringer's paper. We hope to add details for the TSS sites later. | |||
Method | TSS_region |