WormBase Tree Display for Feature: WBsf505211
expand all nodes | collapse all nodes | view schema
WBsf505211 | SMap | S_parent | Sequence | VC5 |
---|---|---|---|---|
Sequence_details | Flanking_sequences | TCCATTCTGTGAAAAGCTCTGGTATGGAGA | AGAAGCTTCATTCCAAGAGAAAGCGGCCAA | |
Mapping_target | VC5 | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | C01B12.2 Binding Peaks in L2 larva from strain OP343 | ||
SO_term | SO:0000235 | |||
Defined_by | Defined_by_paper | WBPaper00037946 | ||
WBPaper00035968 | ||||
Defined_by_analysis | modENCODE_3371_Snyder_TF_C01B12.2 | |||
Score | 0.002708 | |||
Associations | Associated_with_transcription_factor | WBTranscriptionFactor000736 | ||
Bound_by_product_of | WBGene00015285 | |||
Remark | [120612 gw3] This is a modENCODE project from the Snyder Lab to find TF binding site regions by using ChIP-SEQ immunoprecipitation using an antibody to the TF or to PolII and then sequencing on a Solexa GA2 machine. | |||
Method | TF_binding_site_region |