WormBase Tree Display for Feature: WBsf268568
expand all nodes | collapse all nodes | view schema
| WBsf268568 | SMap | S_parent | Sequence | E04D5 |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | CTGGTACTTCACATGGTAGCTAGCGTGTATAGGTTGCCTGATGACCGGCA | GCATTTTATGCCTACGCGGAACGCCTATATTTTTCATTAGGTTATCATTT | |
| Mapping_target | E04D5 | |||
| DNA_text | tagcgtgtataggttgcctgatgaccggcaGgcattttatgcctacgcggaacgcctatat | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | Possible genome sequence error found in analysis of N2 and the sister strain LSJ2 RNASeq data | ||
| has NO EST evidence; | ||||
| Insertion tagcgtgtataggttgcctgatgaccggcaGgcattttatgcctacgcggaacgcctatat | ||||
| Possible genome sequence error found in RNASeq analysis of ten lab isolates of N2 by Kate Weber. | ||||
| Marked for correction. | ||||
| Defined_by | Defined_by_paper | WBPaper00037807 | ||
| WBPaper00040097 | ||||
| Remark | This genome error was corrected in WS235. | |||
| Method | Corrected_genome_sequence_error |
