WormBase Tree Display for Feature: WBsf240211
expand all nodes | collapse all nodes | view schema
WBsf240211 | SMap | S_parent | Sequence | B0205 | ||
---|---|---|---|---|---|---|
Sequence_details | Flanking_sequences | CAGTTCGTGAGAAAAAAAACTGTTACTTGT | AATCAATATTGTCTTTGGTTTGAAAAACCT | |||
Mapping_target | B0205 | |||||
Source_location | 190 | CHROMOSOME_I | 10736604 | 10736605 | ||
Origin | Species | Caenorhabditis elegans | ||||
Visible | Description | This polyA_site feature was defined by the Bartel paper. | ||||
polyA site | ||||||
SO_term | SO:0000553 | |||||
Defined_by | Defined_by_sequence | elegans_PE_SS_GG6543|c5_g1_i1 | Inferred_automatically | make_missing_tsl_features.pl | ||
elegans_PE_SS_GG6543|c5_g2_i1 | Inferred_automatically | make_missing_tsl_features.pl | ||||
Defined_by_paper | WBPaper00037808 | |||||
Associations | Associated_with_transcript | B0205.7.1 | ||||
Remark | [110125 gw3] This polyA_site feature was defined by the Bartel paper. | |||||
Bartel data confident_cleavagesite score: 889.0 | ||||||
Method | polyA_site |