WormBase Tree Display for Feature: WBsf1026934
expand all nodes | collapse all nodes | view schema
WBsf1026934 | SMap | S_parent | Sequence | Y54G2A |
---|---|---|---|---|
Name | Public_name | distal lin-22 promoter | ||
Sequence_details | Flanking_sequences | gagtacatccgtaaacagagagcaaagaaa | aaaacaattttgagtttcatgaaacaataa | |
Mapping_target | Y54G2A | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | This is the 'distal lin-22 promoter' promoter region (in lin-22(icb38)) for WBGene00003008. | ||
SO_term | SO:0000167 | |||
Defined_by | Defined_by_paper | WBPaper00053295 | ||
Associations | Associated_with_gene | WBGene00003008 | ||
Associated_with_expression_pattern | Expr13575 | |||
Remark | See Supporting information file pbio.2002429.s001.docx in the paper WBPaper00053295. [2018-04-27 gw3] | |||
Method | promoter |