WormBase Tree Display for Expr_pattern: Expr7254
expand all nodes | collapse all nodes | view schema
Expr7254 | Expression_of (2) | ||||
---|---|---|---|---|---|
Homol | Homol_homol | ZK792:Expr | |||
Expression_data | Life_stage | WBls:0000041 | |||
WBls:0000023 | |||||
Anatomy_term | WBbt:0005738 | Partial | |||
Remark | unidentified cells | ||||
WBbt:0005772 | Certain | ||||
Type | Reporter_gene | [inx-9::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTTTAATTTTGTAACGTTCGACCC] 3' and primer B 5' [CATTCTGTCCCTTTGAACCAA] 3'. | |||
Pattern | Adult Expression: intestine; unidentified cells in body ; | ||||
Larval Expression: intestine; unidentified cells in body ; | |||||
Remark | Also expressed in (comments from author) : Unidentified cells in reproductive system.Embryo incomplete. To be updated. | ||||
Strain: BC11010 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00002445 |