WormBase Tree Display for Expr_pattern: Expr7254
expand all nodes | collapse all nodes | view schema
| Expr7254 | Expression_of | Gene | WBGene00002131 |
|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00002131 | ||
| Homol | Homol_homol | ZK792:Expr | |
| Expression_data (2) | |||
| Type | Reporter_gene | [inx-9::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTTTAATTTTGTAACGTTCGACCC] 3' and primer B 5' [CATTCTGTCCCTTTGAACCAA] 3'. | |
| Pattern | Adult Expression: intestine; unidentified cells in body ; | ||
| Larval Expression: intestine; unidentified cells in body ; | |||
| Remark | Also expressed in (comments from author) : Unidentified cells in reproductive system.Embryo incomplete. To be updated. | ||
| Strain: BC11010 | |||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00002445 |
