WormBase Tree Display for Expr_pattern: Expr7227
expand all nodes | collapse all nodes | view schema
Expr7227 | Expression_of | Gene | WBGene00014001 | |
---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00014001 | |||
Homol | Homol_homol | CHROMOSOME_IV:Expr | ||
Expression_data | Life_stage | WBls:0000041 | ||
WBls:0000023 | ||||
Anatomy_term | WBbt:0005772 | Certain | ||
Type | Reporter_gene | [ZK593.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTCGGAAAAGTGGACTTAATCA] 3' and primer B 5' [TACATGATGATGGACGGGC] 3'. | ||
Pattern (2) | ||||
Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. | |||
Strain: BC12367 | ||||
Reference | WBPaper00006525 | |||
Transgene | WBTransgene00002901 |