WormBase Tree Display for Expr_pattern: Expr7114
expand all nodes | collapse all nodes | view schema
| Expr7114 | Expression_of | Gene | WBGene00022240 |
|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00022240 | ||
| Homol | Homol_homol | Y73B6BL:Expr | |
| Expression_data (2) | |||
| Type | Reporter_gene | [Y73B6BL.19::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACTTTTGGCTTGAGACCACTATTC] 3' and primer B 5' [GCGATTCTGAAGAAGACAACG] 3'. | |
| Pattern | Adult Expression: intestine; | ||
| Larval Expression: intestine; | |||
| Remark | Also expressed in (comments from author) : incomplete. To be updated. | ||
| Strain: BC10566 | |||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00002314 |
