WormBase Tree Display for Expr_pattern: Expr7071
expand all nodes | collapse all nodes | view schema
Expr7071 | Expression_of | Gene | WBGene00013276 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00013276 | ||
Homol | Homol_homol | Y57A10B:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term | WBbt:0005735 | ||
WBbt:0005772 | |||
Type | Reporter_gene | [Y57A10B.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAATTTTAGGTGGCTTGCAAAA] 3' and primer B 5' [CATCAGCTCTCACGCTTGATT] 3'. | |
Pattern (2) | |||
Remark | Also expressed in (comments from author) : Multiple neurons in head tail and body. Probably OLQ, and inter- and motor neurons in lateral and anterior ganglia (Sengupta Lab 2005) | ||
Strain: BC12008 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002787 |