Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr7062

expand all nodes | collapse all nodes | view schema

Name Class

Expr7062Expression_ofGeneWBGene00021929
Reflects_endogenous_expression_ofWBGene00021929
HomolHomol_homolY55F3AM:Expr
Expression_data (2)
TypeReporter_gene[Y55F3AM.12::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GACGCTTTGATTGTTTAGATTTGA] 3' and primer B 5' [CGTCGCTGATACTGGTTCCT] 3'.
PatternAdult Expression: pharynx; intestine; anal depressor muscle; body wall muscle; excretory cell; Nervous System; nerve ring; head neurons;
Larval Expression: pharynx; intestine; anal depressor muscle; Reproductive System; developing vulva; body wall muscle; excretory cell; Nervous System; nerve ring; head neurons;
RemarkStrain: BC13983
ReferenceWBPaper00006525
TransgeneWBTransgene00003355