WormBase Tree Display for Expr_pattern: Expr7038
expand all nodes | collapse all nodes | view schema
Expr7038 | Expression_of | Gene | WBGene00006888 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00006888 | ||
Homol | Homol_homol | Y54E10A:Expr | |
Expression_data (2) | |||
Type | Reporter_gene | [vbh-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACACTGGGATGCCTACGAAC] 3' and primer B 5' [GACTATATCAAACGGAAACCCG] 3'. | |
Pattern | Adult Expression: pharynx; intestine; | ||
Remark | Also expressed in (comments from author) : incomplete. Will be updated. | ||
Strain: BC11338 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002568 |