WormBase Tree Display for Expr_pattern: Expr7032
expand all nodes | collapse all nodes | view schema
| Expr7032 | Expression_of | Gene | WBGene00000023 |
|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00000023 | ||
| Homol | Homol_homol | Y53C10A:Expr | |
| Expression_data (2) | |||
| Type | Reporter_gene | [abt-5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCCATTTGTTGTTTGTTGTT] 3' and primer B 5' [gattttcaagaaagccgattg] 3'. | |
| Pattern | Adult Expression: intestine; unidentified cells in head; | ||
| Larval Expression: intestine; unidentified cells in head; | |||
| Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. | ||
| Strain: BC10042 | |||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00002050 |
