WormBase Tree Display for Expr_pattern: Expr7027
expand all nodes | collapse all nodes | view schema
Expr7027 | Expression_of | Gene | WBGene00001817 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00001817 | ||
Homol | Homol_homol | Y50E8A:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term | WBbt:0003681 | ||
WBbt:0005735 | |||
WBbt:0005747 | |||
WBbt:0005772 | |||
WBbt:0005800 | |||
WBbt:0005821 | |||
WBbt:0006748 | |||
WBbt:0006751 | |||
WBbt:0006759 | |||
Type | Reporter_gene | [haf-7::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAATACGCACTAAAAGGTAGGGC] 3' and primer B 5' [TATTGGCTTGATTTTTCCTCAAA] 3'. | |
Pattern | Adult Expression: pharynx; intestine; rectal epithelium; Reproductive System; vulval muscle; Nervous System; head neurons; tail neurons; | ||
Larval Expression: pharynx; intestine; rectal epithelium; Reproductive System; developing vulva; Nervous System; head neurons; tail neurons; | |||
Picture (3) | |||
Remark | Also expressed in (comments from author) : Note: primers are not unique and produce 5 products. | ||
Strain: BC15017 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00003831 |