WormBase Tree Display for Expr_pattern: Expr6998
expand all nodes | collapse all nodes | view schema
Expr6998 | Expression_of | Gene | WBGene00012966 | ||
---|---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00012966 | ||||
Homol | Homol_homol | Y48A6B:Expr | |||
Expression_data | Life_stage | WBls:0000041 | |||
WBls:0000023 | |||||
Anatomy_term | WBbt:0005739 | Partial | |||
Remark | unidentified cells | ||||
WBbt:0005772 | |||||
Type | Reporter_gene | [Y48A6B.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGTATCACCATCTTTATCCACAA] 3' and primer B 5' [TTTAGAACGGGATTTGCTGTG] 3'. | |||
Pattern | Adult Expression: intestine; | ||||
Larval Expression: intestine; unidentified cells in head; | |||||
Remark | Also expressed in (comments from author) : 2 unidentified cells in the head.Mosaic population. | ||||
Strain: BC13251 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00004534 |