Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6982

expand all nodes | collapse all nodes | view schema

Name Class

Expr6982Expression_ofGeneWBGene00012903
Reflects_endogenous_expression_ofWBGene00012903
HomolHomol_homolY46G5A:Expr
Expression_data (2)
TypeReporter_gene[Y46G5A.12::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCGTGTAGAACGAAGTGG] 3' and primer B 5' [CCGAACAGGAAATCGATCTG] 3'.
PatternAdult Expression: pharynx; anal depressor muscle; Reproductive System; vulval muscle; body wall muscle; unidentified cells in body ;unidentified cells in tail ;
Larval Expression: pharynx; anal depressor muscle; body wall muscle; unidentified cells in body ;unidentified cells in tail ;
RemarkAlso expressed in (comments from author) : This strain is no longer available.
Strain: BC10580
ReferenceWBPaper00006525
TransgeneWBTransgene00004255