Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6981

expand all nodes | collapse all nodes | view schema

Name Class

Expr6981Expression_ofGeneWBGene00001758
Reflects_endogenous_expression_ofWBGene00001758
HomolHomol_homolY45G12C:Expr
Expression_data (2)
TypeReporter_gene[gst-10::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGAGCGTTTGCACTTCCA] 3' and primer B 5' [CGTACGAGCTCTTATCGTTTAGGT] 3'.
PatternAdult Expression: intestine; anal depressor muscle; hypodermis; Nervous System; head neurons; amphids; tail neurons; phasmids;
Larval Expression: intestine; anal depressor muscle; hypodermis; Nervous System; head neurons; amphids; tail neurons; phasmids;
RemarkAlso expressed in (comments from author) : Note: primers are not unique and produce 2 products. Can predict correct product.
Strain: BC12145
ReferenceWBPaper00006525
TransgeneWBTransgene00002838