Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6974

expand all nodes | collapse all nodes | view schema

Name Class

Expr6974Expression_ofGeneWBGene00012846
Reflects_endogenous_expression_ofWBGene00012846
HomolHomol_homolY44A6B:Expr
Expression_data (2)
TypeReporter_gene[srxa-14::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCTTTTTATGATTGCCTGCC] 3' and primer B 5' [TGATCTCAAAAGAGGTTTCACTG] 3'.
PatternAdult Expression: pharynx; intestine; rectal gland cells; hypodermis; Nervous System; head neurons;
Larval Expression: pharynx; intestine; rectal gland cells; hypodermis; Nervous System; head neurons;
RemarkAlso expressed in (comments from author) : ADL amphid neuron. Strong and consistent expression in an interneuron that may be AIY. Weaker and less consistent expression in ADL. (Sengupta Lab 2005).
Strain: BC14775
ReferenceWBPaper00006525
TransgeneWBTransgene00003708