WormBase Tree Display for Expr_pattern: Expr6974
expand all nodes | collapse all nodes | view schema
Expr6974 | Expression_of | Gene | WBGene00012846 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00012846 | ||
Homol | Homol_homol | Y44A6B:Expr | |
Expression_data (2) | |||
Type | Reporter_gene | [srxa-14::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCTTTTTATGATTGCCTGCC] 3' and primer B 5' [TGATCTCAAAAGAGGTTTCACTG] 3'. | |
Pattern | Adult Expression: pharynx; intestine; rectal gland cells; hypodermis; Nervous System; head neurons; | ||
Larval Expression: pharynx; intestine; rectal gland cells; hypodermis; Nervous System; head neurons; | |||
Remark | Also expressed in (comments from author) : ADL amphid neuron. Strong and consistent expression in an interneuron that may be AIY. Weaker and less consistent expression in ADL. (Sengupta Lab 2005). | ||
Strain: BC14775 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00003708 |