Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6964

expand all nodes | collapse all nodes | view schema

Name Class

Expr6964Expression_ofGeneWBGene00021506
Reflects_endogenous_expression_ofWBGene00021506
HomolHomol_homolY41D4A:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (21)
TypeReporter_gene[Y41D4A.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATCGAGAAAAACTCTGCAATATCC] 3' and primer B 5' [TACCCGGATGGCTTTGAA] 3'.
PatternAdult Expression: pharynx; pharyngeal gland cells; intestine; stomato-intestinal muscle; anal depressor muscle; Reproductive System; uterus; uterine-seam cell; uterine muscle; vulval muscle; body wall muscle; head mesodermal cell; hypodermis; seam cells; coelomocytes; unidentified cells in head; unidentified cells in tail ;
Larval Expression: pharynx; pharyngeal gland cells; intestine; Reproductive System; distal tip cell; developing vulva; developing uterus; body wall muscle; head mesodermal cell; hypodermis; seam cells; unidentified cells in head; unidentified cells in tail ;
RemarkAlso expressed in (comments from author) : Mosaic population.Sometimes cell bodies in head, perhaps neural? or arcade?
Strain: BC12912
ReferenceWBPaper00006525
TransgeneWBTransgene00004501