Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6934

expand all nodes | collapse all nodes | view schema

Name Class

Expr6934Expression_of (2)
HomolHomol_homolY37E11AR:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (12)
TypeReporter_gene[Y37E11AR.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CGGTGAGCACAATTTCCC] 3' and primer B 5' [TTACTGATCAGCGAAGGCAGT] 3'.
PatternAdult Expression: Reproductive System; distal tip cell; vulval muscle; gonad sheath cells; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons;
Larval Expression: intestine; Reproductive System; distal tip cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons;
RemarkStrain: BC14523
ReferenceWBPaper00006525
TransgeneWBTransgene00004589