Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6928

expand all nodes | collapse all nodes | view schema

Name Class

Expr6928Expression_ofGeneWBGene00021331
Reflects_endogenous_expression_ofWBGene00021331
Expression_data (2)
TypeReporter_gene[Y34D9A.6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGCGCATTTGCAGAATTTTT] 3' and primer B 5' [GGCTTTTGAGATGGTTTTTCTG] 3'.
PatternAdult Expression: pharynx; intestine; Reproductive System; vulval muscle; body wall muscle;
Larval Expression: pharynx; intestine; body wall muscle;
RemarkAlso expressed in (comments from author) : Note: primers are not unique and produce 2 products.
Strain: BC12037
ReferenceWBPaper00006525
TransgeneWBTransgene00002799