WormBase Tree Display for Expr_pattern: Expr6928
expand all nodes | collapse all nodes | view schema
Expr6928 | Expression_of | Gene | WBGene00021331 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00021331 | ||
Expression_data (2) | |||
Type | Reporter_gene | [Y34D9A.6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGCGCATTTGCAGAATTTTT] 3' and primer B 5' [GGCTTTTGAGATGGTTTTTCTG] 3'. | |
Pattern | Adult Expression: pharynx; intestine; Reproductive System; vulval muscle; body wall muscle; | ||
Larval Expression: pharynx; intestine; body wall muscle; | |||
Remark | Also expressed in (comments from author) : Note: primers are not unique and produce 2 products. | ||
Strain: BC12037 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002799 |