Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6906

expand all nodes | collapse all nodes | view schema

Name Class

Expr6906Expression_ofGeneWBGene00021225
Reflects_endogenous_expression_ofWBGene00021225
HomolHomol_homolY19D10A:Expr
Expression_data (2)
TypeReporter_gene[Y19D10A.10::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCTCCGATTCACTGAAAAGC] 3' and primer B 5' [TTTAATATTTTGGCGGAAGTTAGA] 3'.
PatternAdult Expression: intestine; Nervous System; head neurons; tail neurons; unidentified cells;
Larval Expression: intestine; Nervous System; head neurons; tail neurons;
RemarkAlso expressed in (comments from author) : Note: primers are not unique and produce 2 products. Can predict correct product.
Strain: BC11566
ReferenceWBPaper00006525
TransgeneWBTransgene00002622