WormBase Tree Display for Expr_pattern: Expr6889
expand all nodes | collapse all nodes | view schema
| Expr6889 | Expression_of | Gene | WBGene00013766 |
|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00013766 | ||
| Homol | Homol_homol | Y113G7B:Expr | |
| Expression_data (2) | |||
| Type | Reporter_gene | [Y113G7B.17::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGCAAGTCGTCTGACATGATT] 3' and primer B 5' [AGTCGACCTGCAGGCATGCAAGCT CCCGCTGGAAAAAGGTTAAT] 3'. | |
| Pattern | Adult Expression: pharynx; anal depressor muscle; unidentified cells in head; | ||
| Larval Expression: pharynx; intestine; unidentified cells in head; | |||
| Remark | Also expressed in (comments from author) : Mosaic population.Embryo incomplete. To be updated.Strain not available. | ||
| Strain: BC10240 | |||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00002150 |
