Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6830

expand all nodes | collapse all nodes | view schema

Name Class

Expr6830Expression_ofGeneWBGene00021004
Reflects_endogenous_expression_ofWBGene00021004
HomolHomol_homolW03F9:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (22)
TypeReporter_gene[W03F9.10::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTCCACCTGATTTGACTTCATTC] 3' and primer B 5' [CGCCTGAGATCTGAAAAAGG] 3'.
PatternAdult Expression: pharynx; intestine; anal depressor muscle; rectal epithelium; Reproductive System; distal tip cell; vulval muscle; vulva other; spermatheca; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in head; unidentified cells in body ;unidentified cells in tail ;
Larval Expression: pharynx; intestine; anal depressor muscle; rectal epithelium; Reproductive System; distal tip cell; developing gonad; developing vulva; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in head; unidentified cells in body ;unidentified cells in tail ;
Picture (4)
RemarkStrain: BC13594
ReferenceWBPaper00006525
TransgeneWBTransgene00003218