Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6767

expand all nodes | collapse all nodes | view schema

Name Class

Expr6767Expression_of (2)
HomolHomol_homolT25G12:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (14)
TypeReporter_gene[rab-6.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCCTGCAATGCCTGAAGTA] 3' and primer B 5' [TACCAAAGTCCGAGATTTTTCTG] 3'.
PatternAdult Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; vulval muscle; body wall muscle; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in head; unidentified cells in tail ;
Larval Expression: anal depressor muscle; body wall muscle; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in head; unidentified cells in tail ;
PictureWBPicture0000006485
RemarkStrain: BC11322
ReferenceWBPaper00006525
TransgeneWBTransgene00002559