WormBase Tree Display for Expr_pattern: Expr6735
expand all nodes | collapse all nodes | view schema
Expr6735 | Expression_of | Gene | WBGene00020662 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00020662 | ||
Homol | Homol_homol | T21H3:Expr | |
Expression_data (2) | |||
Type | Reporter_gene | [T21H3.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCAATATTCCCAAAAAGTGTCAAA] 3' and primer B 5' [GCAGTAAGGCTTGGATACTGAAA] 3'. | |
Pattern | Adult Expression: intestine; | ||
Larval Expression: intestine; | |||
Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. | ||
Strain: BC11507 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002613 |