Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6657

expand all nodes | collapse all nodes | view schema

Name Class

Expr6657Expression_ofGeneWBGene00020391
Reflects_endogenous_expression_ofWBGene00020391
HomolHomol_homolT10B5:Expr
Expression_data (2)
TypeReporter_gene[T10B5.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GATCCTAGCTGCTTTGGTCCT] 3' and primer B 5' [GCATGATCTTGCTCTGAATTTG] 3'.
PatternAdult Expression: pharynx; Nervous System; ventral nerve cord; head neurons; unidentified cells in head; unidentified cells in body ;unidentified cells in tail ;
Larval Expression: pharynx; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in head; unidentified cells in body ;unidentified cells in tail ;
RemarkStrain: BC12510
ReferenceWBPaper00006525
TransgeneWBTransgene00002956