WormBase Tree Display for Expr_pattern: Expr6579
expand all nodes | collapse all nodes | view schema
Expr6579 | Expression_of | Gene | WBGene00011399 | ||
---|---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00011399 | ||||
Homol | Homol_homol | T03F6:Expr | |||
Expression_data | Life_stage | WBls:0000041 | |||
WBls:0000023 | |||||
Anatomy_term | WBbt:0005741 | Partial | |||
Remark | unidentified cells | ||||
WBbt:0005747 | |||||
WBbt:0005772 | |||||
WBbt:0005793 | |||||
WBbt:0006748 | |||||
Type | Reporter_gene | [T03F6.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCAATTTTTCGGTGAAAATCAATA] 3' and primer B 5' [TGGGCTGAAATCAAATTAGAAAA] 3'. | |||
Pattern (2) | |||||
Picture | WBPicture0000006187 | ||||
WBPicture0000006188 | |||||
WBPicture0000006189 | |||||
WBPicture0000006190 | |||||
WBPicture0000006191 | |||||
Remark | Also expressed in (comments from author) : good example of arcade cells | ||||
Strain: BC14672 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00004595 |