WormBase Tree Display for Expr_pattern: Expr6559
expand all nodes | collapse all nodes | view schema
Expr6559 | Expression_of | Gene | WBGene00020140 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00020140 | ||
Homol | Homol_homol | T01B11:Expr | |
Expression_data (2) | |||
Type | Reporter_gene | [T01B11.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTTGCGGCTACAGTGTTCT] 3' and primer B 5' [CTTACCTCCAGACATGCTTGC] 3'. | |
Pattern | Adult Expression: intestine; | ||
Larval Expression: intestine; unidentified cells in body ; | |||
Remark | Also expressed in (comments from author) : unidentified part of the developing reprodctive system in larvae | ||
Strain: BC13886 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00003317 |