Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6551

expand all nodes | collapse all nodes | view schema

Name Class

Expr6551Expression_ofGeneWBGene00011274
Reflects_endogenous_expression_ofWBGene00011274
HomolHomol_homolR53:Expr
Expression_data (2)
TypeReporter_gene[R53.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GAATTTCAACCGTTTCCTAGCTT] 3' and primer B 5' [AATGCGATTTTCTGAAAGAAGAAG] 3'.
PatternAdult Expression: pharynx; head mesodermal cell; coelomocytes; Nervous System; nerve ring; ventral nerve cord; head neurons;
Larval Expression: pharynx; intestine; rectal gland cells; head mesodermal cell; coelomocytes; Nervous System; nerve ring; ventral nerve cord; head neurons;
RemarkAlso expressed in (comments from author) : No comments.
Strain: BC16323
ReferenceWBPaper00006525
TransgeneWBTransgene00004207