WormBase Tree Display for Expr_pattern: Expr6550
expand all nodes | collapse all nodes | view schema
Expr6550 | Expression_of | Gene | WBGene00011302 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00011302 | ||
Homol | Homol_homol | R166:Expr | |
Expression_data (2) | |||
Type | Reporter_gene | [R166.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATTTTCGTGACTGGACAATCG] 3' and primer B 5' [GTCGGCGATTCTGTGAAGA] 3'. | |
Pattern | Adult Expression: intestine; body wall muscle; hypodermis; seam cells; Nervous System; head neurons; | ||
Larval Expression: intestine; hypodermis; seam cells; Nervous System; head neurons; | |||
Picture | WBPicture0000006143 | ||
WBPicture0000006144 | |||
WBPicture0000006145 | |||
Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. | ||
Strain: BC12794 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00004380 |